Sequence ID | >W1810076322 |
Genome ID | PEIJ01000001 |
Search identical group | |
Phylum/Class | Fusobacteriota |
Species | Fusobacterium vincentii subsp. vincentii KCOM 2880 [PEIJ] |
Start position on genome | 800580 |
End posion on genome | 800505 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
agtaaatatg |
tRNA gene sequence |
GTGACCGTAGTTCAGTTGGTAGAGCGCCAGTTTGTGGCACTGGTTGTCGCGAGTTCGAGC |
Downstream region at tRNA end position |
tttgcgtcat |
Secondary structure (Cloverleaf model) | >W1810076322 His GTG g CCCA tttgcgtcat G - C T - A G - C A - T C - G C - G G - C C G T T G C T C A T G A A + | | | | G T C T T G G C G A G C G | | + | T T G G A G C T A G TTGTC C - G C - G A - T G - C T - A T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |