Sequence ID | >W1810080107 |
Genome ID | PENF01000002 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Prevotella intermedia KCOM 2698 [PENF] |
Start position on genome | 27606 |
End posion on genome | 27533 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
aacgaaatat |
tRNA gene sequence |
GCACCCTTAGCTCAGTTGGTAGAGCAACTGACTCTTAATCAGTGGGTCTAGGGTTCGAGT |
Downstream region at tRNA end position |
tttcagtgca |
Secondary structure (Cloverleaf model) | >W1810080107 Lys CTT t ACac tttcagtgca G + T C - G A - T C - G C - G C - G T - A T G T A T C C C A T G A A | | | | | G T C T C G T A G G G C G | | | | T T G G A G C T A A GGGTC A - T C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |