Sequence ID | >W1810081416 |
Genome ID | PEOH01000045 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Staphylococcus pseudintermedius 2.08072E+12 [PEOH] |
Start position on genome | 108204 |
End posion on genome | 108131 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gtggagccaT |
tRNA gene sequence |
GGCCCCTTGGTCAAGCGGTTAAGACACCGCCCTTTCACGGCGGTAACACGGGTTCGAGTC |
Downstream region at tRNA end position |
agtcagaagt |
Secondary structure (Cloverleaf model) | >W1810081416 Glu TTC T ATat agtcagaagt G - C G + T C - G C - G C - G C - G T - A T G T T G C C C A C G A G | | | | | G G A C T G A C G G G C G | | | T T T A G A C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |