Sequence ID | >W1810085759 |
Genome ID | PFXK01000014 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio sp. HA2012 [PFXK] |
Start position on genome | 186 |
End posion on genome | 261 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tatttcgtgt |
tRNA gene sequence |
GCTGATATAGCTCAGGTGGTAGAGCGCATCCTTGGTAAGGATGAGGTCCCCAGTTCGAGT |
Downstream region at tRNA end position |
gttatttact |
Secondary structure (Cloverleaf model) | >W1810085759 Thr GGT t ACCA gttatttact G - C C - G T - A G - C A - T T - A A - T T G T G G G T C A G G A A | | | | | G T C T C G C C C A G C G | | | | T T G G A G C T A G AGGTC C - G A - T T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |