Sequence ID | >SRA1002411 |
Genome ID | SRR001323.72759 |
Phylum/Class | Metagenomic signatures of the Peru Margin subseafloor biosphere (SRP000183) |
Species | |
Start position on genome | 12 |
End posion on genome | 105 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
caaataaaat |
tRNA gene sequence |
GGAGAGGTGGCTGAGTGGTCGAAAGCGGTCGCCTGCTAAGCGATTAAGTGCCCATAAAGG |
Downstream region at tRNA end position |
gtttagagnn |
Secondary structure (Cloverleaf model) | >SRA1002411 Ser GCT t GCCA gtttagagnn G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G T C G G A G G G C G | | | T T T A A G C C G A G TAAGTGCCCATAAAGGTGCTTC G + T T - A C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |