Sequence ID | >SRA1002474 |
Genome ID | SRR001324.57466 |
Search identical group | |
Phylum/Class | Metagenomic signatures of the Peru Margin subseafloor biosphere (SRP000183) |
Species | |
Start position on genome | 113 |
End posion on genome | 41 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
nnnnnnnnnc |
tRNA gene sequence |
GGGCAGGTAGCTCAGTTGGTAGAGCAACGGACTGAAAATCCGTGTGTCGGCGGTTCAAAT |
Downstream region at tRNA end position |
atttaagttg |
Secondary structure (Cloverleaf model) | >SRA1002474 Phe GAA c Attg atttaagttg G - C G - C G - C C - G A - T G - C G - C T A T C C G C C A T G A A | | | | | A T C T C G G G C G G C G | | | | T T G G A G C T A A GTGTC A - T C - G G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |