Sequence ID | >SRA1002475 |
Genome ID | SRR001324.61072 |
Search identical group | |
Phylum/Class | Metagenomic signatures of the Peru Margin subseafloor biosphere (SRP000183) |
Species | |
Start position on genome | 22 |
End posion on genome | 107 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
cgcccactat |
tRNA gene sequence |
GCCGAAGTGGCGGAATGGCAGACGCGCTACGTTCAGGGCGTAGTGCCCGTAAGGGTGTGG |
Downstream region at tRNA end position |
tcannnnnnn |
Secondary structure (Cloverleaf model) | >SRA1002475 Leu CAG t ACCA tcannnnnnn G - C C - G C - G G - C A - T A - T G - C T A T C C C T C A T A A G | | | | | A G G G C G G G G A G C G | | | T T C A C G C A G G TGCCCGTAAGGGTGT C - G T - A A - T C - G G - C T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |