Sequence ID | >SRA1002497 |
Genome ID | SRR001325.14534 |
Search identical group | |
Phylum/Class | Metagenomic signatures of the Peru Margin subseafloor biosphere (SRP000183) |
Species | |
Start position on genome | 31 |
End posion on genome | 106 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
tagcaaaggT |
tRNA gene sequence |
GGGCCGCTAGCTCAGTCTGGAAGAGCAACAGGCTCTTAACCTGTGGGTCGGGGGTTCAAA |
Downstream region at tRNA end position |
ttnnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1002497 Lys CTT T GTat ttnnnnnnnn G - C G - C G - C C - G C - G G - C C - G T A T C T C C C A T G A A | + | | | A C C T C G G G G G G C T | | | | T T G G A G C G A A A GGGTC A - T C - G A - T G - C G - C C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |