Sequence ID | >W1810108807 |
Genome ID | PHGS01000014 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Agrobacterium sp. LAD9 [PHGS] |
Start position on genome | 187516 |
End posion on genome | 187440 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tttccactgt |
tRNA gene sequence |
GGCGGGGTAGCTCAGGTGGTTAGAGCAGCGGAATCATAATCCGCGTGTCGGGGGTTCAAG |
Downstream region at tRNA end position |
ctttccttca |
Secondary structure (Cloverleaf model) | >W1810108807 Met CAT t ACCA ctttccttca G + T G - C C - G G - C G - C G - C G + T T G T C T C C C A G G A A | + | | | A T C T C G G G G G G C G | | | | T T G G A G C T T A A GTGTC G - C C - G G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |