Sequence ID | >SRA1002528 |
Genome ID | SRR001325.101652 |
Search identical group | |
Phylum/Class | Metagenomic signatures of the Peru Margin subseafloor biosphere (SRP000183) |
Species | |
Start position on genome | 1 |
End posion on genome | 74 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
nnnnnnnnnT |
tRNA gene sequence |
GCCCTCATCGACTAGCGGTTAGGTCACCACTCTTTCAAGGTGGCAGCGAGGGTTCGAGTC |
Downstream region at tRNA end position |
gataaagatg |
Secondary structure (Cloverleaf model) | >SRA1002528 Glu TTC T AGga gataaagatg G - C C - G C - G C - G T - A C - G A - T T G T C T C C C A C G A C | | | | | G G T C A G G A G G G C G + | | | T T T G G T C T A A CAGC C - G C - G A - T C - G T + G C A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |