| Sequence ID | >SRA1002533 |
| Genome ID | SRR001325.110516 |
| Phylum/Class | Metagenomic signatures of the Peru Margin subseafloor biosphere (SRP000183) |
| Species | |
| Start position on genome | 111 |
| End posion on genome | 37 |
| Amino Acid | Lys |
| Anticodon | TTT |
| Upstream region at tRNA start position |
nnnnnnttgt |
| tRNA gene sequence |
GGGCCGTTAGCTCAGACCGGTAGAGCAGCGGACTTTTAATCCGTTGGTCGCGCGTTCGAT |
| Downstream region at tRNA end position |
cccacttttt |
| Secondary structure (Cloverleaf model) | >SRA1002533 Lys TTT
t ACtt cccacttttt
G - C
G - C
G - C
C - G
C - G
G - C
T - A T T
T C G C G C A
A G A A | | | | | G
C C T C G G C G C G C
C | | | | T T
G G A G C
G T A A TGGTC
G + T
C - G
G - C
G - C
A - T
C A
T A
T T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |