Sequence ID | >SRA1002536 |
Genome ID | SRR001325.123328 |
Phylum/Class | Metagenomic signatures of the Peru Margin subseafloor biosphere (SRP000183) |
Species | |
Start position on genome | 3 |
End posion on genome | 100 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
nnnnnnnnag |
tRNA gene sequence |
GGGAGCGGTTGAGTCCCGGTGGGCTTCGCGGACTTCAAATCCGTCGTGGGGCAATTAAAA |
Downstream region at tRNA end position |
cttttgctta |
Secondary structure (Cloverleaf model) | >SRA1002536 SeC TCA g GCCA cttttgctta G - C G - C G - C A - T G - C C - G G - C G G T C T T A C C C A C C C T + | | | | G G T G A G G T G G G C G + | | + T T T G C T T G G C CGTGGGGCAATTAAAAGTGTCTTTG G + T C - G G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |