Sequence ID | >SRA1002678 |
Genome ID | SRR001663.352415 |
Search identical group | |
Phylum/Class | Synechococcus metagenome reveals major roles for horizontal gene transfer and plasmids in population diversity (SRP000219) |
Species | |
Start position on genome | 9 |
End posion on genome | 81 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
nncgctttaa |
tRNA gene sequence |
GAGTATATAGCTCAGCTGGTAGAGCATCGGACTTTTAATCCGCGGGTCTTGGGTTCAAAT |
Downstream region at tRNA end position |
ctttctttta |
Secondary structure (Cloverleaf model) | >SRA1002678 Lys TTT a Aata ctttctttta G - C A - T G - C T - A A - T T - A A - T T A T A A C C C A C G A A | | | | | A T C T C G T T G G G C G | | | | T T G G A G C T A A GGGTC T C C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |