| Sequence ID | >SRA1002778 |
| Genome ID | SRR002326.3245 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 41 |
| End posion on genome | 117 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
ggagtctagt |
| tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCATCTGCTTTGGGAGCAGAGGGTCGTGAGTTCGAA |
| Downstream region at tRNA end position |
cagttgaaca |
| Secondary structure (Cloverleaf model) | >SRA1002778 Pro TGG
t ACCA cagttgaaca
C - G
G - C
G - C
G - C
G - C
C - G
G - C T A
T C A C C C A
C G A A | | | | G
C C G C G G T G A G C
T | | | | T T
G G C G C
G T A A GGGTC
T - A
C - G
T - A
G - C
C - G
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |