| Sequence ID | >SRA1002801 | 
| Genome ID | SRR002326.29434 | 
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) | 
| Species | |
| Start position on genome | 144 | 
| End posion on genome | 226 | 
| Amino Acid | Tyr | 
| Anticodon | GTA | 
| Upstream region at tRNA start position | gccaagttac | 
| tRNA gene sequence | GGAGAGTTGTCCGAGTGGTCGAAGGAGGCTGCCTGTAAAGCAGTTCGTCAAGCACGCTGG | 
| Downstream region at tRNA end position | ttcactttnn | 
| Secondary structure (Cloverleaf model) | >SRA1002801	Tyr	GTA
                   c      ACCA ttcactttnn
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     T - A          T A
                    T     C G A C C     A
      T G A        G      | | | | |     G
    G       G C C T       G C T G G     C
    G         | | |                 T T
    T       A G G A
      C G A        G     TCGTCAAGCAC
                    G + T
                    C - G
                    T - A
                    G - C
                    C - G
                  C       A
                  T       A
                    G T A
 | 
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] | 
| Comment | |
| --- | |
| Input Comment |