Sequence ID | >SRA1002834 |
Genome ID | SRR002326.46698 |
Search identical group | |
Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
Species | |
Start position on genome | 145 |
End posion on genome | 69 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttggcctgta |
tRNA gene sequence |
GGTGATATAGCTCAGTTGGTTAGAGCGCAGCATTCATAATGCTGATGTCGGTGGTTCAAG |
Downstream region at tRNA end position |
cggattttca |
Secondary structure (Cloverleaf model) | >SRA1002834 Met CAT a ACCA cggattttca G - C G - C T - A G - C A - T T - A A - T T G T C C A C C A T G A A | | | | | A T C T C G G G T G G C G | | | | T T G G A G C T T A G ATGTC C - G A - T G - C C - G A - T T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |