Sequence ID | >W1810144829 |
Genome ID | PIOB01000001 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Arenibacter hampyeongensis JCM 17788 [PIOB] |
Start position on genome | 633711 |
End posion on genome | 633637 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
agccaaaatt |
tRNA gene sequence |
GGGGGATTAGCTCAGCTGGCTAGAGCGCTTGCCTGGCAGGCAAGAGGTCACCGGTTCGAC |
Downstream region at tRNA end position |
tcaagcgcaa |
Secondary structure (Cloverleaf model) | >W1810144829 Ala GGC t ACga tcaagcgcaa G - C G - C G + T G - C G + T A - T T - A T C T T G G C C A C G A A | | | | | G T C T C G A C C G G C G | | | | T T G G A G C C T A G AGGTC C - G T - A T - A G - C C - G C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |