| Sequence ID | >SRA1002901 |
| Genome ID | SRR002326.87286 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 84 |
| End posion on genome | 157 |
| Amino Acid | Gly |
| Anticodon | CCC |
| Upstream region at tRNA start position |
cgcactaact |
| tRNA gene sequence |
GCGGGTGTAGCTCAATGGCAGAGCTGTTGCTTCCCAAGCAACTGACGAGGGTTCGATTCC |
| Downstream region at tRNA end position |
cagcgcccag |
| Secondary structure (Cloverleaf model) | >SRA1002901 Gly CCC
t TCCA cagcgcccag
G - C
C - G
G - C
G - C
G - C
T - A
G - C T T
T T T C C C A
A A A + | | | | G
T C T C G G A G G G C
G | | | | T T
G G A G C
C A T TGAC
G - C
T - A
T - A
G - C
C - G
T A
T A
C C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |