| Sequence ID | >SRA1002908 |
| Genome ID | SRR002326.94649 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 91 |
| End posion on genome | 17 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
cagacgtacc |
| tRNA gene sequence |
GGCGGGGTGGAGAAGCTTGGTATCTCGTCGGGCTCATAACCCGAAGGCCGCAGGTTCAAA |
| Downstream region at tRNA end position |
ttttcttacg |
| Secondary structure (Cloverleaf model) | >SRA1002908 Met CAT
c ACtt ttttcttacg
G + T
G - C
C - G
G - C
G - C
G - C
G - C T A
T C G T C C A
C G A G | | | | | A
T A G A G G C A G G C
T | | | | T T
G T C T C
G T A G AGGCC
T - A
C - G
G - C
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |