| Sequence ID | >SRA1002926 |
| Genome ID | SRR002326.104164 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 153 |
| End posion on genome | 67 |
| Amino Acid | Leu |
| Anticodon | CAG |
| Upstream region at tRNA start position |
ctcgcaacct |
| tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCGCCAGCTTCAGGTGCTGGTATTGGTAACGATGTG |
| Downstream region at tRNA end position |
ttcccccggt |
| Secondary structure (Cloverleaf model) | >SRA1002926 Leu CAG
t ACCA ttcccccggt
G - C
C - G
C - G
C - G
A - T
G - C
G - C T G
T T T T C C A
T A A G + | | | | G
T G G C G G A A G G C
G | | | T T
G A C G C
T A G G TATTGGTAACGATGT
C - G
C - G
A - T
G - C
C - G
T T
T G
C A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |