Sequence ID | >SRA1002930 |
Genome ID | SRR002326.106876 |
Search identical group | |
Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
Species | |
Start position on genome | 160 |
End posion on genome | 234 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
gtagaggcgG |
tRNA gene sequence |
GCTGATGTAGCTCAGTTGGTAGAGCGCGTCCTTGGGTAAGACGAGGTCACCGGTTCAATT |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1002930 Pro GGG G TTnn nnnnnnnnnn G - C C - G T - A G - C A - T T - A G - C T T T T G G C C A T G A A | | | | | A T C T C G A C C G G C G | | | | T T G G A G C T A G AGGTC C - G G - C T - A C - G C A T A T T G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |