| Sequence ID | >SRA1002937 |
| Genome ID | SRR002326.110128 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 104 |
| End posion on genome | 178 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
cctctcggat |
| tRNA gene sequence |
GCGGGTGTAGCTCAGTGGTAGAGCACGACCTTGCCAAGGTCGGGGTCGAGGGTTCGAATC |
| Downstream region at tRNA end position |
agacttcccc |
| Secondary structure (Cloverleaf model) | >SRA1002937 Gly GCC
t TCCA agacttcccc
G - C
C - G
G - C
G - C
G - C
T + G
G - C T A
T T T C C C A
G A A + | | | | G
T C T C G G A G G G C
G | | | | T T
G G A G C
T A A GGGTC
C - G
G - C
A - T
C - G
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |