Sequence ID | >W1810155549 |
Genome ID | PJAU01000032 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Colwellia sp. 75C3 [PJAU] |
Start position on genome | 485717 |
End posion on genome | 485641 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
aagaatatgt |
tRNA gene sequence |
CGGTGATTAGCGCAGCTTGGTAGCGCACTTGGTTTGGGTCCAAGGGGTCGCAAGTTCGAA |
Downstream region at tRNA end position |
ctttcttttt |
Secondary structure (Cloverleaf model) | >W1810155549 Pro TGG t ACCA ctttcttttt C - G G - C G - C T - A G - C A - T T - A T A T C G T T C A C G A A | | | | | G T C G C G G C A A G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A G - C G - C T T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |