Sequence ID | >W1810155673 |
Genome ID | PJAV01000166 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudoalteromonas sp. 78C3 [PJAV] |
Start position on genome | 38911 |
End posion on genome | 38835 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
agccaacaat |
tRNA gene sequence |
GGCTAAGTAGCTCAGCTGGTTAGAGCACATCACTCATAATGATGGGGTCACAGGTTCAAA |
Downstream region at tRNA end position |
tttctttttt |
Secondary structure (Cloverleaf model) | >W1810155673 Met CAT t ACCA tttctttttt G - C G - C C - G T - A A - T A - T G - C T A T T G C C C A C G A A | | | | A T C T C G A C A G G C G | | | | T T G G A G C T T A A GGGTC C - G A - T T - A C - G A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |