Sequence ID | >W1810155988 |
Genome ID | PJBA01000006 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Colwellia sp. Bg11-28 [PJBA] |
Start position on genome | 727708 |
End posion on genome | 727783 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ctctcatgaa |
tRNA gene sequence |
GCGGCTGTAGCTCAGCTGGTAGAGCATCACGTTGCCAACGTGAATGTCACGAGTTCGAGT |
Downstream region at tRNA end position |
attttagtta |
Secondary structure (Cloverleaf model) | >W1810155988 Gly GCC a TCCA attttagtta G - C C - G G - C G - C C - G T - A G + T T G T T G C T C A C G A A | | | | | G T C T C G A C G A G C G | | | | T T G G A G C T A A ATGTC T - A C - G A - T C - G G - C T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |