Sequence ID | >W1810157344 |
Genome ID | PJBW01000012 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Olleya sp. 1-3 [PJBW] |
Start position on genome | 16201 |
End posion on genome | 16276 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
cctattatta |
tRNA gene sequence |
GGGCGACTAGCTCAGTTGGTTCAGAGCACTTGGTTTACACCCAAGGGGTCAGGGGTTCGA |
Downstream region at tRNA end position |
aaaaaatccg |
Secondary structure (Cloverleaf model) | >W1810157344 Val TAC a ACaa aaaaaatccg G - C G - C G - C C - G G - C A - T C - G T A T T T C C C A T T G A A | + | | | G G C T C G A G G G G C G | | | | T T T G A G C T C A A GGGTC C - G T - A T - A G - C G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |