Sequence ID | >W1810157915 |
Genome ID | PJCF01000002 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Paraglaciecola sp. MB-3u-78 [PJCF] |
Start position on genome | 329250 |
End posion on genome | 329326 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
agtataatgt |
tRNA gene sequence |
TCCCCCTTAGCTCAGCTGGTTAGAGCGACGGACTGTTAATCCGCAGGTCCCCTGTTCGAG |
Downstream region at tRNA end position |
acttatactg |
Secondary structure (Cloverleaf model) | >W1810157915 Asn GTT t GCCA acttatactg T - A C - G C - G C - G C - G C - G T - A T G T G G G G C A C G A A | | | + | G T C T C G C C C T G C G | | | | T T G G A G C T T A G AGGTC A C C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |