| Sequence ID | >SRA1003045 |
| Genome ID | SRR002326.169214 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 70 |
| End posion on genome | 142 |
| Amino Acid | Gln |
| Anticodon | TTG |
| Upstream region at tRNA start position |
tttcgtcgct |
| tRNA gene sequence |
GGTTCTATAGTGTAATTGGTTAGCACCCAAGGTTTTGATCCTTGTAATCCGGGTTCAAGT |
| Downstream region at tRNA end position |
tgtgagcggg |
| Secondary structure (Cloverleaf model) | >SRA1003045 Gln TTG
t Tttt tgtgagcggg
G - C
G - C
T - A
T - A
C - G
T - A
A - T T G
T G G C C C A
T A A A | | | | | A
T T G T G C C G G G C
G + | | | T T
G G C A C
T T A C TAAT
C - G
A - T
A - T
G - C
G - C
T T
T A
T T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |