| Sequence ID | >SRA1003057 |
| Genome ID | SRR002326.174794 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 23 |
| End posion on genome | 96 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
atttcaagtT |
| tRNA gene sequence |
GCGCTCGTGGTCTAGTGGTTATGATCGTCGCTTGCCAAGTGATGGACCCGGGTTCAATTC |
| Downstream region at tRNA end position |
ttttttttct |
| Secondary structure (Cloverleaf model) | >SRA1003057 Gly GCC
T ATgc ttttttttct
G - C
C - G
G - C
C - G
T - A
C - G
G - C T T
T G G C C C A
T G A G | | | | | A
G T C T G C C G G G C
G | | + T T
T T G A T
T A C GGAC
G + T
T - A
C - G
G + T
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |