| Sequence ID | >SRA1003126 |
| Genome ID | SRR002326.226415 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 250 |
| End posion on genome | 165 |
| Amino Acid | Tyr |
| Anticodon | GTA |
| Upstream region at tRNA start position |
tcgcttcgaa |
| tRNA gene sequence |
GGATGGGTGTCCGAGTGGCTAAAGGAGGCAGACTGTAAATCTGCTCGCTAACGCGTACGC |
| Downstream region at tRNA end position |
attttgtttt |
| Secondary structure (Cloverleaf model) | >SRA1003126 Tyr GTA
a ACCA attttgtttt
G - C
G - C
A - T
T - A
G - C
G - C
G - C T A
T C G A C C A
T G A G | | | | | G
G G C C T G C T G G C
G | | | T T
C A G G A
T A A G TCGCTAACGCGTAC
G - C
C - G
A - T
G - C
A - T
C A
T A
G T A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |