Sequence ID | >W1810169634 |
Genome ID | PJKE01000003 |
Search identical group | |
Phylum/Class | Verrucomicrobiota |
Species | Akkermansia muciniphila GP25 [PJKE] |
Start position on genome | 217241 |
End posion on genome | 217168 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
cgcatttcat |
tRNA gene sequence |
GCGGGCGTCGTTCAATGGTAGGACGCGAGCTTCCCAAGCTTGAGACGTGGGTTCGATTCC |
Downstream region at tRNA end position |
cttttatacc |
Secondary structure (Cloverleaf model) | >W1810169634 Gly CCC t ACCA cttttatacc G + T C - G G - C G - C G - C C - G G - C T T T T A C C C A A A C + | | | | G T C T T G G T G G G C G | + | | T T G G G A C T A G AGAC C - G G + T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |