| Sequence ID | >SRA1003135 |
| Genome ID | SRR002326.233247 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 154 |
| End posion on genome | 78 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
acggaccctg |
| tRNA gene sequence |
GGCTTGGTAGCTCAGCTGGTTAGAGCGGTGGATTCATAACCCACAGGTCGGCGGTTCAAG |
| Downstream region at tRNA end position |
gggtccggcg |
| Secondary structure (Cloverleaf model) | >SRA1003135 Met CAT
g ACCA gggtccggcg
G - C
G - C
C - G
T - A
T - A
G - C
G - C T G
T C C G C C A
C G A A | | | | | A
T C T C G G G C G G C
G | | | | T T
G G A G C
T T A G AGGTC
G - C
T - A
G - C
G - C
A C
T A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |