| Sequence ID | >SRA1003140 |
| Genome ID | SRR002326.237755 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 99 |
| End posion on genome | 174 |
| Amino Acid | Phe |
| Anticodon | GAA |
| Upstream region at tRNA start position |
cggtcgctca |
| tRNA gene sequence |
GGCCAAGTAGCTCAGTTGGTAGAGCAGCGGATTGAAAATCCGCGTGTCGGTGGTTCGATT |
| Downstream region at tRNA end position |
cccccacaag |
| Secondary structure (Cloverleaf model) | >SRA1003140 Phe GAA
a ACCA cccccacaag
G - C
G - C
C - G
C - G
A - T
A - T
G - C T T
T C C G C C A
T G A A | | + | | G
T C T C G G G T G G C
G | | | | T T
G G A G C
T A A GTGTC
G - C
C - G
G - C
G - C
A - T
T A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |