Sequence ID | >W1810172060 |
Genome ID | PJME01000029 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Streptomyces geranii A301 [PJME] |
Start position on genome | 6735 |
End posion on genome | 6662 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
agcgtcttac |
tRNA gene sequence |
GCGGGTGTAGTTTAGTGGTAGAACATCAGCTTCCCAAGCTGAGAGTGCGAGTTCGATTCT |
Downstream region at tRNA end position |
gaatgaaacc |
Secondary structure (Cloverleaf model) | >W1810172060 Gly CCC c TCCA gaatgaaacc G - C C - G G - C G - C G - C T - A G - C T T T T G C T C A G A A + | | | | G T T T T G G C G A G C G + | | | T T G G A A C T A A GAGT T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |