Sequence ID | >W1810174386 |
Genome ID | PJOS01000004 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Streptomyces populi A249 [PJOS] |
Start position on genome | 71434 |
End posion on genome | 71507 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ccacctccaa |
tRNA gene sequence |
GGACGATTAGCTCAGCGGGAGAGCGCTTCCCTGACACGGAAGAGGTCACTGGTTCAATCC |
Downstream region at tRNA end position |
gtccgcaagg |
Secondary structure (Cloverleaf model) | >W1810174386 Val GAC a ACCg gtccgcaagg G - C G - C A - T C - G G - C A - T T - A C T T T G A C C A G A A | | | | | A C C T C G A C T G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A C - G C - G C C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |