| Sequence ID | >SRA1003224 |
| Genome ID | SRR002326.315786 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 91 |
| End posion on genome | 17 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
tgattaacat |
| tRNA gene sequence |
AGGCGTATAGTGAAATGGTCATCACGCGACCCTGATAAGGTCGTATTTCCGGTTCGAGCC |
| Downstream region at tRNA end position |
tgagtatgag |
| Secondary structure (Cloverleaf model) | >SRA1003224 Ile GAT
t ACTA tgagtatgag
A - T
G - C
G - C
C - G
G + T
T - A
A - T C G
T G G G C C A
T A A A + | | | | G
G A G T G T C C G G C
G | | | | T T
T T C A C
C A G TATT
C - G
G - C
A - T
C - G
C - G
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |