Sequence ID | >W1810179343 |
Genome ID | PJSP01000005 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium perfringens SAF-1 [PJSP] |
Start position on genome | 21313 |
End posion on genome | 21238 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aatttaatga |
tRNA gene sequence |
CGCGGGATGGAGCAGCTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTAGGTTCAAGT |
Downstream region at tRNA end position |
caaaaggttc |
Secondary structure (Cloverleaf model) | >W1810179343 Met CAT a ACCA caaaaggttc C A G - C C - G G - C G - C G - C A - T T G T C G T C C A C G A G | + | | | A T C G A G G T A G G C G | | | | T T G G C T C T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |