Sequence ID | >W1810183476 |
Genome ID | PKAP01000023 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Francisella tularensis subsp. holarctica B.87 [PKAP] |
Start position on genome | 16521 |
End posion on genome | 16446 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ctttgctatc |
tRNA gene sequence |
GGGTGCTTAGCTCAGCTGGGAGAGCATCGCCCTTACAAGGCGAGGGTCGGGGGTTCGAAC |
Downstream region at tRNA end position |
tgatttaaaa |
Secondary structure (Cloverleaf model) | >W1810183476 Val TAC c ACCA tgatttaaaa G - C G - C G - C T - A G - C C - G T - A C A T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C G A A GGGTC T - A C - G G - C C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |