| Sequence ID | >SRA1003336 |
| Genome ID | SRR002326.398333 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 78 |
| End posion on genome | 153 |
| Amino Acid | Lys |
| Anticodon | CTT |
| Upstream region at tRNA start position |
ccgaacaagc |
| tRNA gene sequence |
GGACGCATAGCTCAGTTGGTAGAGCAGCTGACTCTTAATCAGCGGGTCCTTGGTTCGAGC |
| Downstream region at tRNA end position |
tttgttttta |
| Secondary structure (Cloverleaf model) | >SRA1003336 Lys CTT
c ACCA tttgttttta
G - C
G - C
A - T
C - G
G - C
C - G
A - T C G
T G A A C C A
T G A A | | | | | G
T C T C G C T T G G C
G | | | | T T
G G A G C
T A A GGGTC
G - C
C - G
T - A
G - C
A - T
C A
T A
C T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |