Sequence ID | >W1810189203 |
Genome ID | PKIW01000089 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lactobacillus crispatus UMB0085 [PKIW] |
Start position on genome | 1116 |
End posion on genome | 1191 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
cccgcaattT |
tRNA gene sequence |
GGTCCATTGGAGCAGTGGTTTATCTCGCCTCCCTGTCACGGAGGAGATCATGGGTTCAAA |
Downstream region at tRNA end position |
gatggctcgg |
Secondary structure (Cloverleaf model) | >W1810189203 Asp GTC T GTaa gatggctcgg G - C G - C T - A C - G C - G A - T T - A T A T T A C C C A T G A G | | | | | A G C G A G A T G G G C G | | | T T T T C T C T T A G AGATC C - G C - G T - A C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |