| Sequence ID | >SRA1003342 |
| Genome ID | SRR002326.402286 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 230 |
| End posion on genome | 146 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
caacccttaa |
| tRNA gene sequence |
GCGGATATGGCGAAATTGGCAGACGCACCAGACTTAGGATCTGGCGGAGCAATCCATGTA |
| Downstream region at tRNA end position |
aaaaattgaa |
| Secondary structure (Cloverleaf model) | >SRA1003342 Leu TAG
a ACAA aaaaattgaa
G - C
C - G
G - C
G - C
A - T
T - A
A - T C C
T T A T C C A
T A A G + | | | | G
T A G C G G T A G G C
G | | | T T
G A C G C
C A G A CGGAGCAATCCAT
C - G
C - G
A - T
G - C
A - T
C A
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |