Sequence ID | >W1810192710 |
Genome ID | PKMT01000001 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Variovorax sp. RO1 [PKMT] |
Start position on genome | 2175661 |
End posion on genome | 2175735 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
cagtgtctca |
tRNA gene sequence |
GGGCGGTTAGCTCAGGGGTAGAGCACAGCATTCACACTGCTGGGGTCGGAGGTTCGAAAC |
Downstream region at tRNA end position |
attagaccca |
Secondary structure (Cloverleaf model) | >W1810192710 Val CAC a ACCA attagaccca G - C G - C G - C C - G G - C G - C T - A A A T C C T C C A G A A | | | | | G G C T C G G G A G G C G | | | | T T G G A G C T A A GGGTC C - G A - T G - C C - G A - T T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |