Sequence ID | >SRA1003392 |
Genome ID | SRR002326.433566 |
Search identical group | |
Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
Species | |
Start position on genome | 167 |
End posion on genome | 94 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
atcactagcc |
tRNA gene sequence |
GGCAACGTGACCGAGCGGCTAGGTAGAGGTCTGCAAAACCTCCTACAGCGGTTCGAATCC |
Downstream region at tRNA end position |
cctgcttcgc |
Secondary structure (Cloverleaf model) | >SRA1003392 Cys GCA c TCCC cctgcttcgc G - C G - C C - G A - T A - T C - G G - C T A T T C G C C A G A G | | | | | G C G C C A A G C G G C G | | | T T G A G G T C T A CTAC G - C A - T G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |