Sequence ID | >W1810195092 |
Genome ID | PKQJ01000013 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lacticaseibacillus paracasei DUP 13076 [PKQJ] |
Start position on genome | 28743 |
End posion on genome | 28670 |
Amino Acid | Ile |
Anticodon | TAT |
Upstream region at tRNA start position |
gctcgcttac |
tRNA gene sequence |
GTAGATGTAGCTCAATCGGTAGAGCGCGCAACTTATAATTGCGTGGGTGCAGGTTCAAGC |
Downstream region at tRNA end position |
acctcaatgt |
Secondary structure (Cloverleaf model) | >W1810195092 Ile TAT c ACtc acctcaatgt G - C T - A A - T G - C A - T T + G G - C C G T C G T C C A T A A A | | | | | A C C T C G G C A G G C G | | | | T T G G A G C T A G TGGGT C - G G - C C - G A - T A - T C A T A T A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |