| Sequence ID | >SRA1003407 |
| Genome ID | SRR002326.442143 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 139 |
| End posion on genome | 63 |
| Amino Acid | Arg |
| Anticodon | TCT |
| Upstream region at tRNA start position |
tcgaccccaa |
| tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCACGAGACTTCTAATCTTGAGGCCGCTGGTTCGAA |
| Downstream region at tRNA end position |
tacctcgtac |
| Secondary structure (Cloverleaf model) | >SRA1003407 Arg TCT
a GCCA tacctcgtac
G - C
C - G
G - C
C - G
C - G
C - G
G - C T A
T C G A C C A
C G A A | | | | | G
T C T C G G C T G G C
G | | | | T T
G G A G C
A T A A AGGCC
C - G
G + T
A - T
G - C
A - T
C A
T A
T C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |