| Sequence ID | >SRA1003414 |
| Genome ID | SRR002326.452468 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 185 |
| End posion on genome | 96 |
| Amino Acid | Ser |
| Anticodon | GCT |
| Upstream region at tRNA start position |
caaacggtct |
| tRNA gene sequence |
GGAGACGTGGGTGAGTGGCTGAAACCAACGCTTTGCTAAAGCGTCATACGGGAAACTGTA |
| Downstream region at tRNA end position |
gccgtgggtc |
| Secondary structure (Cloverleaf model) | >SRA1003414 Ser GCT
t GCCA gccgtgggtc
G - C
G - C
A - T
G - C
A - T
C - G
G - C T A
T C T C T C A
T G A G | | | | | G
G G T G G G A G A G C
G | | | T T
C A A C C
T G A A CATACGGGAAACTGTATC
A - T
C - G
G - C
C - G
T - A
T A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |