Sequence ID | >W1810197084 |
Genome ID | PNJG01000131 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Kocuria tytonis 442 [PNJG] |
Start position on genome | 2527 |
End posion on genome | 2444 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
agggcgtctc |
tRNA gene sequence |
GGCAGGTTACCCGAGCGGCCAAAGGGGGCTGACTGTAAATCAGCTGGCAATGCCTACGGG |
Downstream region at tRNA end position |
agatgatgtg |
Secondary structure (Cloverleaf model) | >W1810197084 Tyr GTA c ACCg agatgatgtg G - C G - C C - G A - T G - C G - C T - A T A T C T C C C A C G A A | + | | | G G G C C C G G G G G C G | | | T T C A G G G C A A G TGGCAATGCCTAC G - C C - G T - A G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |