Sequence ID | >SRA1003427 |
Genome ID | SRR002326.457742 |
Search identical group | |
Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
Species | |
Start position on genome | 65 |
End posion on genome | 154 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gcactgattt |
tRNA gene sequence |
GGAGAGGTGGCAGAGTGGTCGAATGTACCTGATTCGAAATCAGGCGAAGGTGTAAGCCTT |
Downstream region at tRNA end position |
tttcagcaat |
Secondary structure (Cloverleaf model) | >SRA1003427 Ser CGA t GCCA tttcagcaat G - C G - C A - T G - C A - T G + T G - C T A T C A C C C A T G A G | | | | | G G G A C G G T G G G C G | | + T T T A T G T C G A A CGAAGGTGTAAGCCTTCC C - G C - G T - A G - C A - T T A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |