Sequence ID | >W1810210276 |
Genome ID | POHG01000031 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas sp. FW306-02-H05-BA [POHG] |
Start position on genome | 2467 |
End posion on genome | 2551 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ggctcgctta |
tRNA gene sequence |
GGAGGGGTTCCCGAGCGGCCAAAGGGATCAGACTGTAAATCTGACGTCTACGACTTCGAA |
Downstream region at tRNA end position |
tttttagcgt |
Secondary structure (Cloverleaf model) | >W1810210276 Tyr GTA a ACCA tttttagcgt G - C G - C A - T G - C G - C G - C G - C T A T C T T C C A C G A T | | | | | G G G C C C G A A G G C G | | | T T C A G G G C A A A CGTCTACGACTTC T - A C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |