| Sequence ID | >SRA1003585 |
| Genome ID | SRR002327.50024 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 10 |
| End posion on genome | 85 |
| Amino Acid | Phe |
| Anticodon | GAA |
| Upstream region at tRNA start position |
ntcgcgctca |
| tRNA gene sequence |
GGCCCGGTAGCTCAGTCGGTAGAGCAGAGGATTGAAAATCCTTGTGTCGGTGGTTCGATT |
| Downstream region at tRNA end position |
gtattcatgc |
| Secondary structure (Cloverleaf model) | >SRA1003585 Phe GAA
a ACCA gtattcatgc
G - C
G - C
C - G
C - G
C A
G - C
G - C T T
T C C G C C A
T G A A | | + | | G
C C T C G G G T G G C
G | | | | T T
G G A G C
T A A GTGTC
G + T
A - T
G - C
G - C
A - T
T A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |